(PDF) MOLECULAR PHYLOGENETICS OF THE HAWAIIAN

September 13, 2018 | Author: Anonymous | Category: Documents
Share Embed


Short Description

Therefore, the bog species appear to have undergone convergent evolution of ..... 1998) are examples of endemic Hawaiian...

Description

MOLECULAR PHYLOGENETICS OF THE HAWAIIAN GERANIUMS

SARAH ELIZABETH KIDD

A Thesis Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 2005 Committee: Helen J. Michaels, Advisor Scott O. Rogers Juan L. Bouzat

ii ABSTRACT Helen J. Michaels, Advisor

Pax et al. (1997) successfully applied molecular phylogenetics to confirm the monophyly of the Hawaiian Geranium lineage and identified an American origin for the lineage. However, this data from rbcL (a conserved, slowly evolving chloroplast gene) was insufficient for resolution of the pattern of radiation. The objective of this study was to determine the phylogeny of the Hawaiian Geraniums using internal transcribed spacer (ITS) regions of nuclear ribosomal DNA, the noncoding chloroplast (cpDNA) trnL-F region, and inter-simple sequence repeats (ISSR), which are more rapidly evolving molecular markers, in order to understand the pattern of speciation within the group. In this study of the evolution of the lineage, the following hypotheses were tested: 1) G. arboreum is the basal member of the lineage. This hypothesis is based on leaf morphology. Features such as trichome structure, size of lamia, and dentate toothing along the entire edge suggest a more basal position than any other species. 2) The three bog species (G. hanaense, G. hillebrandii, and G. kauaiense) represent a single radiation into a common habitat type on three islands. This has been suggested by morphological analysis (Funk and Wagner 1995). 3) G. cuneatum ssp. tridens, the only subspecies occurring on Maui, is genetically divergent enough to elevate it to specific status as suggested by Funk and Wagner (1995). 4) Maui, where the most taxa occur, is the island of the primary colonization event despite it being the second youngest island. The Geraniums radiated from Maui to

iii Hawai’i and Kaua’i, representing at least one colonization event from a younger, eastern island to an older, western island. Results indicated that a clade comprised of G. arboreum and G. c. hypoleucum occupied the basal position in trees produced by the combined ITS and trnL-F data as well as ISSR data. G. c. tridens sequences did not provide enough evidence to suggest it should be elevated to specific level. Sequence data do not even strongly support the designation of the cuneatums as subspecies. None of the analyses placed all three bog species in a clade to suggest they underwent a single radiation into this habitat. Therefore, the bog species appear to have undergone convergent evolution of morphological traits that enable them to adapt to flooded conditions. The frequently occurring “conveyer belt” mode of colonization and radiation from oldest island to newest island is not supported. G. kauaiense, the only species occurring on Kaua’i, is definitely nested and not basal. The data suggests that Maui, Hawai’i, or an older nowsubmerged island is the origin of the radiation.

iv ACKNOWLEDGEMENTS

Thanks to my Mom and Dad, być dumnym z twój córka. Thanks to my husband Scott, l’amo per sempre.

Thomas Huxley’s reaction to reading Origin of Species was "How stupid of me not to have thought of that."

"Science is a wonderful thing if one does not have to earn one's living at it.” -

Albert Einstein

"Evolution is cleverer than you are." -

Francis Crick

Thanks to my committee for their input. Thanks to the folks in Scott Rogers’ lab for their help with the sequencer. Heaps of thanks to my lab-mates. Chris, Scott, Marcus, Dhan – you guys are great. This research was supported by Department of Biological Science funds.

v TABLE OF CONTENTS Page INTRODUCTION .................................................................................................................

1

METHODS AND MATERIALS........................................................................................... Plant Materials and DNA Extraction PCR Amplifications and Purification of PCR Product (ITS and trnL-F) Sequencing of PCR Products PCR Amplifications and Purification of PCR Product (ISSR) Data Analysis (ITS and trnL-F) Data Analysis (ISSR)

9

RESULTS ............................................................................................................................ ITS trnL-F Combined sequences analysis ISSR

14

DISCUSSION ........................................................................................................................

17

LITERATURE CITED ..........................................................................................................

41

APPENDIX A. Nomenclature of the Hawaiian Geraniums.................................................

47

APPENDIX B. Detailed Protocols ....................................................................................... CTAB Isolation Qiagen Mini Spin Columns PCR – ITS, trnL-F PCR – ISSR Ethanol Precipitation of PCR Product with Sodium Acetate Sequencing Reaction Ethanol Precipitation of Sequencing Reaction with Sodium Acetate Sequencing

48

APPENDIX C. Sequences Obtained in this Study ............................................................... ITS trnL-F

56

vi LIST OF TABLES Table

Page

1

List of Accessions ......................................................................................................

25

2

List of Distribution/Habit Information.......................................................................

26

3

List of Primers............................................................................................................

27

4

ISSR Data from Primer 807.......................................................................................

28

5

ISSR Data from Primer 810.......................................................................................

29

6

Pairwise Distance Matrix (Combined ITS and trnL-F data) ....................................

30

LIST OF FIGURES Figure

Page

1

Map of Hawaiian Geranium Distribution .................................................................

31

2

Phylogeny of the Hawaiian Geraniums Based on Morphology ...............................

32

3

Successful Amplification of ITS PCR Products .......................................................

33

4

Successful Amplification of trnL-F PCR Products ..................................................

33

5

Successful Amplification of ISSR PCR Products.....................................................

34

6

Bootstrap Analysis of ITS.........................................................................................

35

7

Bootstrap Analysis of trnL-F ....................................................................................

36

8

Bootstrap Analysis of Combined Sequences Data (Branch-and-Bound) .................

37

9

Phylogram of Combined Sequences Data (Branch-and-Bound) ..............................

38

10

Bootstrap Analysis of ISSR Data (UPGMA)............................................................

39

11

Phylogenetic Tree with Habit/Habitat Information ..................................................

40

1 INTRODUCTION The genus Geranium comprises about 300 species and has a generally cosmopolitan distribution (Áedo et al. 1998). Genus Geranium is divided into three subgenera: Eroideae, Robertanium, and Geranium, distinguished by fruit dispersal (Cronquist 1981, 1988; Yeo 1984). The majority of Geraniums are herbaceous perennials with highly divided palmately lobed or cleft leaves. In contrast, the Hawaiian Geraniums (subgenus Geranium, section Neurophyllodes) have several unusual morphological features such as shrubby habit, stamens distinct at the base, unlobed leaves with pronounced parallel major veins and apically toothed or serrate margins, and one or both of the leaf surfaces are extremely hirsute (Hillebrand 1888; Wagner et al. 1990). The Hawaiian Geraniums vary in stature from a diffuse tree (G. arboreum) to decumbent shrubs with adventitious nodal rooting (G. kauaiense, G. hillebrandii, and G. hanaense). The section Neurophyllodes was described by Asa Gray (1854) and contains only those Geraniums found on Hawai’i. Although collected as early as 1793 by Archibald Menzies, the Hawaiian Geraniums remain rather obscure taxa since some of its species are rare plants that are poorly represented in herbarium collections. G. arboretum and G. multiflorum are already federally Endangered (US Fish and Wildlife Service 1992), while G. hanaense (1999), G. kauaiense (1997), and G. hillebrandii (1990) are candidates for listing. Morphology has been used to examine relationships among the Hawaiian Geraniums (Wagner et al. 1990), using traits such as leaf margins, size of lamina, and trichome structure. Wagner et al. (1990) recognized nine taxa of Hawaiian Geraniums: G. arboreum, G. multiflorum, G. hillebrandii, G. hanaense, G. kauaiense, G. cuneatum

2 ssp. cuneatum, G. c. ssp. hololeucum, G. c. hypoleucum, and G. c. ssp. tridens. Phylogenetic relationships of the Hawaiian Geraniums have always been unclear. An age estimate for the most recent common ancestor of the Hawaiian Geraniums performed by Price and Clague (2002) suggests that the divergence of historically known Geranium taxa occurred around two million years ago. Carlquist and Bissing (1976) and Funk and Wagner (1995) suggested that G. arboreum and second, G. multiflorum, be considered the most basal members of the phylogeny based on features, such as leaf margins, that are less specialized than the other species (Figure 2). Having bright red zygomorphic flowers, G. arboreum is the only Hawaiian species to be bird-pollinated, while all other Hawaiian Geraniums are insect-pollinated (Carlquist 1980). Although vegetatively less specialized, Medeiros and St. John (1988) ventured that G. arboreum is an unlikely direct ancestor to the other Hawaiian Geraniums. Instead, they hypothesized that a species similar to G. multiflorum evolved in two divergent directions: birdpollinated species (G. arboreum) and insect-pollinated species (all other Hawaiian Geraniums). Carlquist and Bissing (1976) first suggested that G. multiflorum is the ancestor of the G. cuneatum group. G. cuneatum ssp. tridens is thought to be the progenitor of G. hanaense based on characteristics such as pubescence on both leaf faces, reduced serrations on the leaf margin, and altitude of the habitats of both taxa (Medeiros and St. John 1988). Funk and Wagner (1995) elevated G. cuneatum ssp. tridens to specific status and suggested that G. humile (G. hillebrandii) followed by G. kauaiense are the most derived of the Hawaiian Geraniums (Figure 2). The origin and evolution of oceanic island biota have long interested evolutionary biologists. Recent phylogenetic studies of several groups of native Hawaiian vascular

3 plants have led to significant insights into the origin and evolution of the Hawaiian angiosperms, 89% of which are endemic (Sakai et al. 1995; Wagner et al. 1990). The extreme isolation of the Hawaiian Islands permits profuse diversification of species from a single colonist. The extensive range of environmental diversity allows for tremendous selection pressures within short distances of each other. Unfortunately, factors such as non-native plants (banana poka, blackberry, strawberry guava), non-native animals (pigs, goats, mongoose), introduced diseases (avian malaria, avian pox), changes in natural processes (fire/lava flow suppression), habitat fragmentation, and increases in human populations are driving native habitants to extinction (Carlquist 1980; Loope et al. 1988). Hawai’i has only two native mammals: the hoary bat (Lasiurus cinerus hawaiiensis) and the monk seal (Monachus schauinslandi), and no native reptiles. The lack of native mammals and reptiles leaves Hawaiian ecosystems at risk since native species have not evolved defenses to the predators and herbivores that have been introduced in the last 300-1,000 years by Polynesian and Western visitors. Besides being actively introduced, there are many passive ways for species to become established on island ecosystems. Plumose hairs on achenes catch gusts of wind. Coconuts float for thousands of miles across the ocean. Seeds of another plant could “raft” on a coconut or driftwood. External bird dispersal (epizoochory) adaptations such as sticky seeds or barbs to enable them to attach to feet or feathers, and internal bird dispersal (dyszoochory) such as seeds having fleshy fruits or accessory tissues to entice ingestion are hypothesized to be the most common mode of dispersal that allowed plants to colonize Hawai’i (Carlquist 1974; Price and Wagner 2004; Sakai et al. 1995). The Hawaiian Geraniums produce neither plumose achenes, sticky burrs, nor appetizing fruit

4 to suggest an obvious method for seed dispersal. The “ballistic seed-ejection” mechanisms these Geraniums employ rarely manage to project seeds farther than three meters from the parent plant (Yeo 1984). The Pacific Golden Plover (Pluvialis fulva) is a likely vector of a number of native plant introductions into the Hawaiian Islands. It is a frequent visitor to a variety of upland sites, including montane bogs, and is therefore a possible accidental carrier of Geranium seed (Carlquist 1974, 1980). Once a colonist arrives on Hawai’i, the volcanic islands offer virgin habitats. Each colonist has to contend with a partially or entirely new set of conditions, such as competitors, pathogens, and environmental differences, guiding natural selection. Every colonist has the potential to become a new species as it is isolated from the parent population. The geographical arrangement of the Hawaiian Geraniums is an interesting aspect of the group. Each species/subspecies only inhabits one island, species do not occur on every Hawaiian island, and the four subspecies of G. cuneatum have a disconnected distribution over two islands (Figure 1). Each species has a particular habitat and elevation to which it is adapted (Table 2). The question of which island was colonized first remains unanswered. The most common pattern of colonization and speciation in the Hawaiian archipelago has been from older to younger islands (Carson and Kaneshiro 1976; Crawford et al. 1987; Funk and Wagner 1995). Carlquist and Bissing (1976) and Funk and Wagner (1995) propose phylogenies in which the basal members (G. arboreum and G. multiflorum) are endemic to East Maui. The Geraniums radiating from East Maui to West Maui and Kaua’i suggests at least one colonization event from a younger, eastern island to an older, western island. If the Hawaiian Geraniums radiated from East Maui, their evolution must have proceeded rapidly.

5 Haleakala volcano, East Maui, is less than one million years old, while West Maui is less than two million years old (MacDonald et al. 1983). Given the morphological features of the Hawaiian Geraniums that so clearly set them apart from the rest of the genus, a relatively recent arrival to East Maui is unlikely. A more likely explanation is that the progenitor of the Hawaiian Geraniums first colonized an older, now-submerged island and dispersed to East Maui (Funk and Wagner 1995). Although most species on Hawai’i can be traced to Polynesia, an estimated 18% of Hawaiian species have an American origin (Fosberg 1948; Wagner et al. 1990). The Silversword alliance (Asteraceae) (Baldwin et al. 1991; Baldwin and Wessa 2000), Hawaiian mints (Stachys, Lamiaceae) (Lindqvist and Albert 2002), woody Hawaiian violets (Viola, Violaceae) (Ballard and Sytsma 2000), and Hawaiian sanicles (Sanicula, Apiaceae) (Vargas et al. 1998) are examples of endemic Hawaiian groups having American ancestors. Species-level systematics provides a framework for studying evolutionary patterns and processes. The first to study the molecular phylogeny of the Hawaiian Geraniums was Pax et al. (1997), using sequence analysis of PCR amplified fragments of the chloroplast gene rbcL to compare five Hawaiian species to 18 outgroup species in the genus. RbcL gene sequences from the Hawaiian Geraniums were compared with those of a range of taxa from Australia, North America, Mexico, and India in a cladistic analysis in order to clarify its phylogenetic relationship. Pax et al. (1997) found that (1) the Hawaiian Geraniums are strongly supported as being monophyletic; (2) American representatives from Mexico and the western United States (G. vulcanicola, G. subulatostipulatum, and G. richardsonii), are the most similar to the Hawaiian

6 Geraniums; (3) G. arboreum is the basal member of the clade (as suggested by morphology); (4) G. kauaiense, a bog species occurring on the island of Kaua’i, is nested among species from Maui and Hawai’i, suggesting at least one colonization from a younger, eastern island to an older, western island. However, this data from rbcL (a conserved, slowing evolving chloroplast gene) was insufficient for resolution of the pattern of radiation. Molecular markers commonly used for lower-level phylogenetic analysis in plants are the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA, the noncoding chloroplast (cpDNA) trnL-F region, and inter-simple sequence repeats (ISSR). There is a wide acceptance of combination and simultaneous analysis of all available data sets (Bakker et al. 2004; Olmstead and Palmer 1994; Selvi et al. 2004; Small et al. 2004; Yockteng et al. 2003). The internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are well established as being useful in systematics. Their small size (500-700 bp) and high copy number allows for direct sequencing of PCR products and also facilitates the use of dried herbarium specimens and very old material. (Álvarez and Wendel 2003; Baldwin et al. 1995; Small et al. 2004). ITS regions have rates of substitution that are useful for evaluating generic and species level relationships (Baldwin et al. 1995; Gemmill et al. 2002; Yockteng et al. 2003). White et al. (1990) described a list of “universal” eukaryotic primers that are useful for amplifying ITS sequences from most plant and fungal phyla, removing the need for previous sequence information or custom primer design. Chloroplast DNA (cpDNA) is the most widely used source of data in plant molecular phylogenetic analyses. The chloroplast genome contains both coding and non-

7 coding sequences and is found in multiple copies per chloroplast. Coding cpDNA molecules are highly conserved, which has lead to the design of “universal” PCR primers published by Taberlet et al. (1991). The analysis of cpDNA has been of particular interest because it is very informative over a wide range of taxonomic levels. The noncoding cpDNA regions have been used to define phylogenetic relationships among genera, among species, and within species (Baker et al. 1999; Jung et al. 2003; Olmstead and Palmer 1994; Small et al. 2004). ISSR techniques are nearly identical to RAPD techniques except that ISSR primer sequences are designed from microsatellite regions and the annealing temperatures used are higher than those used for RAPD markers. These markers are derived from primers that anchor within the elements themselves, rather than in flanking regions. ISSR primers generate the variation in a given DNA sample by including one of these highly variable microsatellite sequences and an arbitrary pair of bases at the 3’ end. ISSR markers are inherited in a dominant or codominant Mendalian fashion (Gupta et al. 1994; Zietkiewicz et al. 1994). The absence of a band is interpreted as primer divergence or loss of a locus through the deletion of the SSR site or chromosomal rearrangement (Wolfe and Liston 1998). They are highly variable and more robust than RAPDs due to the use of longer anchored primer sequences. Only small amounts of fresh or preserved DNA and small reaction volumes for PCR are required. (Bussell et al. 2004; Wolfe et al. 1998). ISSR markers have been mostly used to assess genetic diversity among populations (Camacho and Liston 2001; Esselman et al. 1999; Maunder et al. 1999) but have also been used to assess the genetic relatedness of cultivars (Martins et al. 2003;

8 Arnau et al. 2002), as well as inter- and intra-species variations (Sudupak 2004; Yockteng et al. 2003).

9 MATERIALS AND METHODS Plant Materials and DNA Extraction: The scientific names of the Hawaiian Geranium species were referred to the taxonomic system of Wagner et al. (1990) (Appendix A). Tissue from G. c. cuneatum was unavailable at the time of the study and was not included. Phylogenetic studies within the genus (Pax et al. 1997) show clearly that the Hawaiian Geraniums are monophyletic and identified a North American origin for the lineage. Species in the genus Geranium subgenus Geranium were used as outgroups: G. richardsonii (North America), G. subulatostipulatum (Mexico), and G. vulcanicola (Mexico). They were the most closely related species to the Hawaiian Geraniums as found by Pax et al. (1997). G. grandiflorum (Himalayas) sequences were obtained in this study and used as an outgroup species, as well as sequences from GenBank for the ITS1, 5.8S ribosomal RNA gene, and ITS2 regions of G. solanderi, G. homeanum, G. sessiliflorum, and G. retrorsum (New Zealand and Australia) (Gardner et al. unpublished) and in the subgenus Robertium, the trnL-trnF intergenic spacer regions of G. robertianum and G. pusilum (Europe, Asia, North Africa, North America) (Bakker et al. 2000). Plant material was collected from natural populations and preserved in silica gel. The accessions, their GenBank accession numbers, and their sources are given in Table 1. At least five DNA isolations from unique individuals were performed per Hawaiian species. Total DNA was extracted by following a modified CTAB method of Doyle and Doyle (1987) and was then purified using a DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA).

10 PCR Amplifications and Purification of ITS and trnL-F PCR Products: Each PCR reaction was 50µl in volume. The PCR reaction mix was prepared before aliquoting it to each tube containing the DNA template. The PCR reaction mix included: 5 μl 10X MgCl2-free PCR buffer (Promega, Madison, WI), 8 μl dNTP mix (1.25 mM each dNTP Promega), 1 μl each Primer (10 μM - Sigma-Genosys, The Woodlands, TX), 5 μl MgCl2 (25 mM - Promega), 0.5 μl Taq DNA polymerase (2.5 Units – Promega), 28.5 μl H2O, 1 μl template. The ITS and trnL-F regions were amplified using primers reported as universal primers by White et al. (1990) and Taberlet et al. (1991), respectively, for flowering plants (see Table 3). The sequences of the primers used are as follows: ITS1 – TCCGTAGGTGAACCTGCGG; ITS4 – TCCTCCGCTTATTGATATGC; TABC – CGAAATCGGTAGACGCTACG; TABF – ATTTGAACTGGTGACACGAG. Amplifications were performed in a PTC-100 thermal cycler (MJ Research, Watertown, MA) under the following amplification profile: 3 minutes at 95°C; 35 cycles of 1 minute at 95°C, 1 minute at 54°C, and 2 minutes at 72°C; and extra extension for 8 minutes at 72°C. Thirteen µl of each double-stranded DNA PCR product were resolved by electrophoresis in 1% agarose gel using 1x TBE as the gel buffer. Successful PCR resulted in a single band of ethidium bromide-incorporated DNA when viewed under ultraviolet (UV) light. PCR products were precipitated with EtOH and sodium acetate before direct sequencing.

Sequencing of PCR Products: Forward and reverse DNA sequences were obtained using the same primers as for PCR reactions in conjunction with a BigDye® Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA). Each reaction was 10 μl in volume and contained 3 µl of sterile distilled water, 2 μl BigDye® 5x Sequencing Buffer,

11 1 μl of primer (10 mM), 1 µl of ethanol-purified PCR product, and 2 µl of BigDye® Terminator v3.1 Cycle Sequencing Ready Reaction Mix. The sequencing reaction was performed in a PTC-100 thermal cycler (MJ Research) under the following amplification profile: 3 minutes at 95°C; 25 cycles of 15 seconds at 95°C, 4 minutes at 60°C, and 2 minutes at 72°C. Cycle sequencing reaction products were precipitated with EtOH and sodium acetate and suspended in 12 μl of template suppression reagent (TSR; Applied Biosystems) or ABI Hi-Di Formamide (Applied Biosystems) before automated cycle sequencing. The majority of the trnL-F sequences were run on an Applied BioSystems 310 automated DNA sequencer at Bowling Green State University. The majority of the ITS sequences were run on an ABI Prism 3700 DNA Analyzer by GeneGateway, LLC (Hayward, CA). All sequences were verified by comparison of their forward and reverse sequences.

PCR Amplifications of ISSR: Each PCR amplification reaction was 25µl in volume. The PCR reaction mix was prepared before aliquoting it to each tube containing the DNA template. The PCR reaction mix included: 2.5 μl 10X MgCl2-free PCR buffer (Promega), 2.5 μl BSA (Bovine Serum Albumin, 4 mg/ml - Promega), 4 μl dNTP mix (1.25 mM each dNTP - Promega), 2 μl each Primer (10 μM - Sigma-Genosys), 2-3 μl MgCl2 (25 mM - Promega), 0.1 μl Taq DNA polymerase (0.5 Units – Promega), and 2 μl template. The regions were amplified using primers reported for flowering plants (UBC primers nos. 807 ((AG)8T) and 810 ((GA)8T), from the Biotechnology Laboratory, University of British Columbia, Canada, and “Manny,” ((CAC)4RC) Wolfe and Liston 1998) (Table 3). Amplification was performed in a PTC-100 thermal cycler (MJ

12 Research) under the following amplification profile: 2 minutes at 94°C; 40 cycles of 40 seconds at 94°C, 45 seconds at 44°C, and 90 seconds at 72°C; and extra extension for 5 minutes at 72°C.

Data Analysis of ITS and trnL-F Sequences: The sequence boundary of the trnL-trnF intergenic spacer region was determined by comparison with published sequences (Baker et al. 1999). The sequences were aligned using the program Clustal-X (Thompson et al. 1997) with the default settings. Among the Hawaiian taxa’s combined sequences, there were seven gaps: five in G. kauaiense and two in G. c. tridens. There were no other insertions or deletions among the Hawaiian sequences. Gaps were treated as missing data. A maximum parsimony analysis (Swofford et al. 1996) was performed using PAUP* 4.0b10 under the branch-and-bound search algorithm. A neighbor-joining analysis was additionally performed on the combination of ITS and trnL-F data. Relative support of various clades revealed in the maximally parsimonious trees (MPTs) was examined with the bootstrap method (Felsenstein 1985) using PAUP* 4.0b10. Bootstrap values were calculated from 1000 replicates (365 replicates for trnL-F sequences) with branch-and-bound search options. Characters were assigned equal weights at all nucleotide positions. The data from ITS and trnL-F were analyzed separately before doing a combined analysis.

Data Analysis of ISSR: The entire PCR product was resolved by electrophoresis in 1.5% agarose gel using 1x TBE as the gel buffer. Successful PCR resulted in multiple bands which were visualized using SYBR® Green I (Molecular Probes, Eugene, OR) nucleic

13 acid gel stain. ISSR profiles were captured digitally with a STORM 860 system at 450nm excitation. Duplicate reactions were run for all ISSR analyses to ensure the reproducibility of banding patterns. Fourteen primers were initially screened and ISSR data from three primers (UBC 807, 810, and “Manny”) were obtained for eight Hawaiian Geranium taxa, G. richardsonii, and G. vulcanicola. ISSR data from “Manny” proved unreliable and was, therefore, excluded from analysis. Fragment sizes were estimated based on 1000kb GeneChoice Ladder II (GeneChoice, Frederick, MD). Each unique fragment size was considered a locus and was scored as diallelic (present=1 or absent=0). Bands of identical size were assumed homologous across species samples. PAUP* 4.0b10 was used to perform a maximum parsimony analysis (Swofford et al. 1996) by using the branch-and-bound algorithm as well as a distance analysis using UPGMA search algorithm. Relative support of various clades revealed in the maximally parsimonious trees (MPTs) was examined with the bootstrap method (Felsenstein 1985).

14 RESULTS ITS: The total length of aligned ITS sequences was 667 base pairs, 574 (86%) of which were invariant, 52 (8%) were parsimony- informative, and 41 (6%) were parsimonyuninformative. The following species were designated as outgroups: G. grandiflorum, G. solanderi, G. homeanum, G. sessiliflorum, and G. retrorsum. A branch-and-bound search using all default settings resulted in two equally-parsimonious trees, each with a length of 116 mutational events (Consistency Index (CI) of 0.853, Retention Index (RI) of 0.893). The 50% majority-rule consensus tree (Figure 6) showed 1) the monophyly of the Hawaiian Geraniums supported by a 100% bootstrap and 2) a basal polytomy with the Hawaiian lineage as five poorly-resolved clades. Some further groupings emerged: G. multiflorum, G. hillebrandii, and G. hanaense were placed in an unresolved clade supported by a 86% bootstrap. G. arboreum and G. c. hypoleucum were grouped together in a second strongly supported clade (84% bootstrap) placed as sister to that of the previous clade.

The node that links the Hawaiian taxa to the N. American taxon G.

richardsonii was supported by a 71% bootstrap and the node that links the Hawaiian taxa to the Mexican taxa was strongly supported by a 99% bootstrap value.

trnL-F: Compared to ITS, the trnL-F region was less variable. The total length of aligned trnL-F sequences was 869 base pairs, 768 (88%) of which were constant, 19 (2%) were parsimony-informative, and 82 (9%) of which were parsimony-uninformative. The following species were designated as outgroups: G. grandiflorum, G. robertianum and G. pusilum. A branch-and-bound search using all default settings resulted in 300 equallyparsimonious trees, each with a length of 106 mutational events (CI of 0.962, RI of

15 0.895). The 50% majority-rule consensus tree (Figure 7) placed G. multiflorum, G. hillebrandii, G. c. tridens, G. hanaense, and G. hololeucum within an unresolved clade moderately supported by a 65% bootstrap. The placement of G. kauaiense as sister to that of the previous clade was supported by a 75% bootstrap. G. arboreum and G. c. hypoleucum had unresolved basal positioning similar to that in the ITS tree. Bootstrap analysis did not provide support for the monophyly of the Hawaiian Geraniums, as was depicted by the 50% majority-rule consensus tree. The node that links the Hawaiian taxa to the American taxa was strongly supported by a 98% bootstrap.

Combined analysis: In the individual analyses of ITS and trnL-F, the American taxa (G. richardsonii, G. vulcanicola, and G. subulatostipulatum) consistently place more closely related to the Hawaiian clade. For the combined analysis, these American taxa were designated as outgroups and the other taxa (G. grandiflorum, G. solanderi, G. homeanum, G. sessiliflorum, G. retrorsum, G. robertianum and G. pusilum) were not included. The trnL-F sequences were reduced to a length of 848 base pairs and the ITS sequences were reduced to a length of 570 base pairs after the removal of taxa not to be included in the combined analysis. The total length of aligned combined sequences was 1497 base pairs, 1419 (95%) of which were invariable, 30 (2%) were parsimony-informative, and 48 (3%) were parsimony-uninformative. The following species were designated as outgroups: G. richardsonii, G. subulatostipulatum, and G. vulcanicola. A branch-and-bound search using all default settings found three equally-parsimonious trees, each with a length of 87 mutational events (CI of 0.936, RI of 0.926). The 50% majority-rule consensus tree (Figure 8) placed G. multiflorum, G. hillebrandii, and G. hanaense together in a clade

16 supported by a 91% bootstrap. G. c. hololeucum and G. c. tridens are placed along with the previous clade forming an unresolved group supported by a 58% bootstrap. G. arboreum and G. c. hypoleucum were placed at a basal position supported by a 66% bootstrap. A branch supported by an 83% bootstrap value places G. kauaiense, nested, between the G. arboreum/G. c .hypoleucum clade and the unresolved G. c. hololeucum/tridens group (Figure 8). Eleven mutational events pair G. arboreum and G. c. hypoleucum and 15 mutational events unite the rest of the Hawaiian taxa. Three shared mutations unite G. hillebrandii, G. hanaense, and G. multiflorum (Figure 9). An identical tree with nearly identical bootstrap values was produced by a neighbor-joining analysis (tree length = 62, CI of 0.936, RI of 0.926) with all default options (Figure 8).

ISSR analysis: A total of 37 fragments were scored, two (5%) of which were constant, 20 (54%) were parsimony-informative, and 15 (41%) were parsimony-uninformative. 70% of the 37 characters consisted of bands shared by at least two species. Due to inconsistencies in amplification, some bands in G. arboreum and G. c. tridens were not scorable. These loci were treated as “missing information” in PAUP* as opposed to the “absence” of a band. G. richardsonii and G. vulcanicola were designated as outgroups. A branch-and-bound search using all default settings resulted in 48 equally-parsimonious trees, each with a length of 52 mutational events (CI of 0.547, RI of 0.147). The 50% majority-rule consensus tree showed a basal polytomy of G. kauaiense and G. richardsonii and placed the rest of the taxa in an unresolved clade supported by a 66% bootstrap. The 50% majority-rule consensus tree from a distance analysis using the UPGMA search algorithm (Figure 10) with all default settings showed a basal polytomy

17 of G. multiflorum, G. hanaense, G. hillebrandii, G. kauaiense, and G. vulcanicola. G. arboreum and G. hypoleucum were grouped together as sister to the polytomy, supported by a 62% bootstrap. This arrangement is consistent with the grouping of these two species in the ITS and combined sequences analysis trees. Finally, G. c. tridens and G. c. hololeucum were grouped as sister to the basal polytomy, weakly supported by a 54% bootstrap.

18 DISCUSSION Phylogenetic analysis of the ITS and trnL-F regions and ISSR data has revealed several new pieces of information that prompt an revision of the phylogenetic tree of the Hawaiian Geraniums from trees previously suggested based on morphological data or rbcL data. G. arboreum is a basal species, even while it is grouped with G. c. hypoleucum. All four analyses suggest this (Figures 8-10). It is surprising that G. c. hypoleucum was considered basal and it was at first believed possibly to be an artifact of very invariant trnL-F sequences. After the analysis of ITS data, the combined sequence analysis and even the ISSR data placed G. c. hypoleucum with G. arboreum with moderately- to strongly-supported bootstrap values (62-84%), it becomes apparent that this is a grouping that may very well be real. In all four analyses (ITS, trnL-F, combined sequences, and ISSR), G. arboreum and G. c. hypoleucum were consistently placed together. In the three sequence analyses (ITS, trnL-F, and combined sequences, Figures 8,9), G. multiflorum, G. hillebrandii, and G. hanaense were grouped together, showing more resolution than analysis of rbcL data in Pax et al. (1997). Although all three species occur on Maui, G. hillebrandii and G. hanaense are bog species, while G. multiflorum is an erect shrub found in upper forest ecotones. RbcL data similarly grouped G. hanaense and G. multiflorum together in a weakly supported, most-derived clade (Pax et al. 1997). This pattern of speciation (Figure 11) is more complicated than phylogenies formed by analyses of morphological characteristics by Funk and Wagner (1995). The monophyly of the Hawaiian Geraniums is strongly supported (Figure 8) which not surprising considering the distance the first colonizer had to travel and the fact

19 that the Geraniums offer no reward to anything that might carry it; it’s a wonder even one colonist reached Hawai’i, let alone multiple colonists at different times. Another interesting result of this study is that the molecular data obtained does not support the suggestion of Funk and Wagner (1995) to elevate G. cuneatum ssp. tridens, the only subspecies occurring on Maui, to specific status. That is not to say that it definitely should not be elevated, rather, the level of divergence in the sequences among all the Hawaiian Geraniums does not even support the designation of subspecies within cuneatum at all. A pairwise distance matrix created from the combined ITS and trnL-F data in PAUP* (Table 6) displays that each cuneatum subspecies is just as distant (if not more distant) from other cuneatum subspecies as it is from any other species. If anything can be gleaned from this matrix at all, it might be that G. c. tridens is more similar to G. c. hololeucum than any other species, which does not support the selective elevation of G. c. tridens to specific level. Granted, the greatest pairwise distance among the Hawaiian taxa is merely 0.00539 (G. hanaense and G. c. hypoleucum) and its significance is questionable. Sequence invariability is not uncommon among Hawaiian taxa (Ballard and Sytsma 2000; Baldwin et al. 1995; Ganders et al. 2000; Gemmill et al. 2002). Perhaps a focused study using ISSR markers that includes all four subspecies of cuneatum will provide the resolution needed to define how they should be classified. If similar amounts of divergence are found both among the cuneatums as well as among each of the cuneatums and other Hawaiian Geraniums (as was found in this study), it could be suggested that all the cuneatums should be elevated to specific status, eliminating the subspecies designation.

20 The bog species (G. hanaense, G. hillebrandii, and G. kauaiense) were not grouped together as Funk and Wagner (1995) suggested in their study of morphological traits, which include bog adaptations such as adventitious nodal rooting as characters for phylogenetic analysis. The molecular data (Figure 11) does not support the hypothesis that the bog species represent a single evolution of bog adaptations followed by radiation into this habitat type on East Maui, West Maui, and Kaua’i. A possible explanation for this incongruence between phylogenies based on morphology versus molecular data is the possibility of convergent evolution of traits such as adventitious nodal rooting (found in G. kauaiense, G. hillebrandii, and G. hanaense). Adventitious nodal rooting is a common trait associated with plants growing in bogs and has even appeared in introduced forest species that do not form such roots in their native habitats (Lanner 1964). Kaua’i, the oldest island, is not the island of initial colonization. The frequently occurring “conveyer belt” mode of colonization and radiation from oldest island to newest island is not supported. G. kauaiense, the only species occurring on Kaua’i, is clearly nested and not basal (Figure 8). The data suggests that Maui, Hawai’i, or an older now-submerged island is the center of the radiation. This is consistent with hypotheses proposed by Carlquist and Bissing (1976), Medeiros and St. John (1988), and Funk and Wagner (1995) based on morphological features as well as phylogenetic trees produced by the study of the rbcL gene (Pax et al. 1997). This implies an uncommon backdispersal to Kaua’i. Some of the other Hawaiian lineages that share this exceptional pattern of radiation include Tetramolopium (Asteraceae) (Lowrey 1995), Schiedea (Caryophyllaceae) (Wagner et al. 1995), and Psychotria (Rubiaceae) (Nepokroeff et al. 2003). When a back-dispersal is found in a phylogeny, it is usually after an initial

21 colonization on and radiation from the oldest island of Kaua’i. In the case of the Hawaiian Geraniums, the back-dispersal is suggested to come after an initial colonization of one of the two youngest islands. Using GIS analyses of changes in geological features, an age estimate for the most recent common ancestor of the Hawaiian Geraniums performed by Price and Clague (2002) suggests that the divergence of historically known Geranium taxa occurred around two million years ago, well after the formation of Kaua’i. The exact pattern of speciation may be related to accidental bird dispersal and/or steered by the volatile volcanic habitat in which these organisms live. Considering their morphological diversity, the sequences of both the ITS and trnL-F regions among the Hawaiian Geraniums were remarkably invariant, which was surprising considering the successful use of these regions in other infra-generic phylogenetic studies. Such sequence invariability is not all that uncommon among Hawaiian taxa (Ballard and Sytsma 2000; Baldwin et al. 1995; Ganders et al. 2000; Gemmill et al. 2002; Lindqvist and Albert 2002). Lack of resolution may be indicative of a relatively recent origin for the Hawaiian Geraniums. Perhaps in the case of the Hawaiian Geraniums, adaptive radiation involved selection for morphological differences controlled by relatively few genes of large effect similar to that of the Hawaiian Silversword alliance, in which rapid morphological diversification has been accompanied by accelerated evolution of genes that regulate developmental processes (Barrier et al. 2001). The adaptive radiation of the Hawaiian Geraniums into many different habitats despite little sequence variation is common occurrence among Hawaiian taxa. The Hawaiian Silversword alliance descended from a member of the Asteraceae family

22 similar to Muir's Tarweed (from California) and is comprised of 30 species in three genera. Plants of the Silversword group occupy every terrestrial habitat in Hawai’i from wet forests to dry forests and from near sea level to alpine shrublands. Although these plants are still closely related, they often look extremely different from one another (Baldwin et al. 1991; Baldwin and Wessa 2000; Barrier et al. 2001). In the case of the Hawaiian lobeliads (Campanulaceae), which also seem to have arisen from a single colonization, there are more than 110 recognized species which inhabit nearly every habitat in Hawai’i. The lobeliads’ habits include alpine bog rosettes, seacliff succulents, and trees, treelets, and shrubs of mesic and wet forest edges and interiors (Givnish et al. 2004). The Hawaiian mints (Lamiaceae) comprise a total of 58 species in three genera and the endemic Hawaiian Bidens consist of 27 species. These two groups represent another example in which broad morphological and ecological variation is maintained in contrast to a strikingly low level of DNA sequence divergence (Ganders et al. 2000; Lindqvist and Albert 2002; Lindqvist et al. 2003). Other examples of extensive adaptive radiation include the Drepanidae (honeycreepers) among birds (James 2004); Drosophilidae (Hawaiian drosophila), Megalagrion (damselflies), and Laupala (crickets) among the insects (Carson and Kaneshiro 1976; Jordan et al. 2003; Shaw 2002); and Tetragnatha (“long-jawed” spiders) among arachnids (Gillespie 2002). In contrast with the majority of organisms on Hawai’i, this study showed that the Hawaiian Geraniums are strongly affiliated with species found in North America which is remarkable, considering the distance between Hawai’i and North America (3,500 km) and that there is no geological evidence for any now-extinct islands which could have served as stepping-stones to the Hawaiian islands. These results are consistent with the

23 results obtained by Pax et al (1997). The Hawaiian Geraniums are in the company of the Silversword alliance (Asteraceae) (Baldwin et al. 1991; Baldwin and Wessa 2000), Hawaiian mints (Stachys, Lamiaceae) (Lindqvist and Albert 2002), woody Hawaiian violets (Viola, Violaceae) (Ballard and Sytsma 2000), and Hawaiian sanicles (Sanicula, Apiaceae) (Vargas et al. 1998), other endemic Hawaiian groups having American ancestors. In this study, ISSR data was employed as an alternative source of data once it was discovered that the ITS and trnL-F regions were relatively invariant. This is not an uncommon strategy (Mort et al. 2003; Yockteng et al. 2003). The limited utility of the ISSR data in this study arises from amplification difficulties across primers and templates. The data the ISSR analysis yielded confirmed the controversial and unexpected results produced by the more analyses of ITS and trnL-F. This demonstrates the potential this method has to assess phylogenetic relationships at the sectional level. A more dedicated study that included more samples per species, as well as more than two primers, would certainly yield more data suitable for phylogenetic analyses. In addition, a study that included a more diverse sampling of outgroups, specifically those from South America, may provide evidence for a South American origin for the Hawaiian Geraniums, as opposed to North American. The new information revealed in this study can be used to amend the current phylogenetic tree of the Hawaiian Geraniums. This study has shown that the Hawaiian Geraniums are an unusual group that needs to be studied further. Not only are the Hawaiian Geraniums important as a part of an island ecosystem, but the Geraniums are atypical among Hawaiian taxa in that the initial colonization event did not occur on

24 Kaua’i, a back-dispersal occurred in the radiation, and they are affiliated with species found in North America. Due to the precarious situation of the endangered Geraniums, further studies need to be done without delay, before any species of the Hawaiian Geraniums are lost.

Table 1: Taxa used for analysis. Sequences newly obtained in this study are indicated by an asterisk. Species G. arboreum* G. multiflorum* G. hanaense* G. hillebrandii* G. kauaiense* G. c. tridens* G. c. hololeucum* G. c. hypoleucum* G. richardsonii* G. subulatostipulatum* G. vulcanicola* G. grandiflorum* G. homeanum G. solanderi G. sessiliflorum G. retrorsum G. robertianum G. pusilum 1

Collection data/source Poli Poli Springs, Maui, Michaels Maui, Michaels Maui, Michaels Pu'u Kukui bog, Maui, Michaels Alaka'i Swamp, Kaua’i, Perlman Maui, Michaels Mauna Kea, Hawaii, Pax & Michaels Mauna Loa, Hawaii, Pax & Michaels Gallatin, CO, MT Veracruz, Mexico, Marquez & Utrera Veracruz, Mexico, Marquez & Utrera Price and Palmer 1993 unpublished unpublished unpublished unpublished Reading, UK Reading, UK

Sequenced by S. Kidd S. Kidd S. Kidd S. Kidd S. Kidd S. Kidd S. Kidd S. Kidd S. Kidd

Regions sequenced ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F ITS1/trnL-F

S. Kidd

ITS1/trnL-F

S. Kidd S. Kidd Gardner et al. 2004 Gardner et al. 2004 Gardner et al. 2004 Gardner et al. 2004 Bakker et al. 2000 Bakker et al. 2000

ITS1/trnL-F ITS1/trnL-F ITS1 ITS1 ITS1 ITS1 trnL-F trnL-F

internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2

Accession #

AY752471.1 AY752467.1 AY752469.1 AY752473.1 AF167152.1 AF167151.1

Table 2. The endemic Hawaiian Geraniums. Information derived from Medeiros and St. John (1988) and Wagner et al. (1990).

Taxon

Distribution

Elevation (m)

Habitat

Maui

1520-2150

Upper forest ecotone

205 m diffuse tree

G. cuneatum ssp. cuneatum

Hawai'i

1550-1830

Subalpine scrub

0.7 m, erect shrub

G. c. hololeucum

Hawai'i

1850-3050

Alpine scrub

0.7 m, erect shrub

G. c. hypoleucum

Hawai'i

1480-2440

Alpine scrub

0.7 m, erect shrub

G. c. tridens

East Maui

2300-3250

Alpine scrub

1.5 m, erect shrub

G. hanaense

East Maui

1679-1680

Montane bog

1.5 m, descumbant shrub

G. hillebrandii

West Maui

1490-1770

Montane bog

0.3 m, erect subshrub

Kaua’i

1220-1250

Montane bog

0.3 m, descumbant subshrub

Maui

1580-2450

Upper forest ecotone

G. arboreum

G. kauaiense G. multiflorum

Max. stature/habit

2.5 m, erect shrub

Table 3. Primers used in this study.

Primer Name

Primer Sequences (5'-3')

Primer Source

TABC

CGAAATCGGTAGACGCTACG

Taberlet et al., 1991

TABF

ATTTGAACTGGTGACACGAG

Taberlet et al., 1991

ITS1

TCCGTAGGTGAACCTGCGG

White et al., 1990

ITS4

TCCTCCGCTTATTGATATGC

White et al., 1990

UBS807

AGAGAGAGAGAGAGAGT

UBS set no. 9

UBS810

GAGAGAGAGAGAGAGAT

UBS set no. 9

ISSR Manny

CACCACCACCACRC

Wolfe and Liston 1998

Table 4. ISSR data from primer 807. Bands were scored as diallelic (1=present, 0=absent).

Band A B C D E F G H I J K L M N O P Q

G. arboreum 0 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 0

G. multiflorum

G. hanaense

G. hillebrandii

G. kauaiense

0 0 1 1 1 0 0 0 1 0 0 0 0 1 0 1 0

0 1 0 1 1 0 0 0 1 0 0 0 0 1 0 1 1

1 0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0

0 0 1 1 1 0 0 0 1 1 0 1 0 0 0 0 0

G. c. tridens 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 0 0

G. c. hololeucum

G. c. hypoleucum

G. richardsonii

G. vulcanicola

1 0 1 1 0 1 0 0 1 0 0 0 0 1 0 0 0

0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0

0 1 0 1 1 0 0 1 0 1 0 1 1 0 1 0 0

1 0 0 1 1 1 0 0 1 0 1 0 0 1 0 0 0

Table 5. ISSR data from primer 810. Bands were scored as diallelic (1=present, 0=absent). Question marks indicate missing data.

Band A B C D E F G H I J K L M N O P Q R S T

G. arboreum 1 ? ? ? ? 1 1 ? ? ? 1 ? ? ? ? ? ? ? ? ?

G. multiflorum 0 0 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0

G. hanaense 0 1 0 1 0 1 1 1 1 0 0 0 1 0 0 0 0 0 0 0

G. hillebrandii 0 0 1 1 1 1 1 1 1 0 0 1 1 0 0 0 0 0 0 0

G. kauaiense 0 0 0 0 0 0 1 1 1 0 0 0 0 1 1 0 0 0 0 0

G. c. tridens ? ? ? ? ? ? ? ? ? ? ? ? ? 1 ? ? ? ? ? ?

G. c. hololeucum

G. c. hypoleucum

G. richardsonii

G. vulcanicola

0 1 0 1 1 0 1 1 1 0 0 0 0 1 0 0 0 0 0 0

0 0 0 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 1 0

0 0 0 0 0 0 1 1 1 0 0 0 0 0 1 1 0 0 1 1

1 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 1 1 1 1

Table 6. A pairwise distance matrix created from the combined ITS and trnL-F data.

G. arboreum G. arboreum

G. c. G. G. G. G. c. G. c. hypoleucum hillebrandii hanaense multiflorum hololeucum tridens

G. G. G. subulatokauaiense richardsonii stipulatum

*

G. c. hypoleucum

0.00202

*

G. hillebrandii

0.00471

0.00538

*

G. hanaense

0.00472

0.00539

0.00000

*

G. multiflorum

0.00471

0.00538

0.00000

0.00000

*

G. c. hololeucum

0.00538

0.00472

0.00268

0.00268

0.00268

*

G. c. tridens

0.00539

0.00472

0.00335

0.00336

0.00335

0.00201

*

G. kauaiense

0.00405

0.00338

0.00337

0.00337

0.00337

0.00270

0.00203

*

G. richardsonii

0.01545

0.01480

0.01742

0.01743

0.01740

0.01807

0.01812

0.01687

*

G. subulatostipulatum

0.02086

0.02023

0.02149

0.02150

0.02147

0.02214

0.02220

0.02097

0.01943

*

G. vulcanicola

0.02019

0.01955

0.02215

0.02216

0.02213

0.02280

0.02286

0.02164

0.01741

0.00804

Figure 1. Island distribution of the endemic Hawaiian Geranium taxa.

hillebrandii

kauaiense

cuneatum ssp. cuneatum cuneatum ssp. hololeucum cuneatum ssp. hypoleucum

arboreum multiflorum hanaense cuneatum ssp. tridens

32 Figure 2. Phylogeny of the Hawaiian Geraniums based on morphological characteristics as proposed by Funk and Wagner (1995).

Geranium arboreum

multiflorum cuneatum tridens hanaense hillebrandii kauaiense

33 Figure 3. PCR product from the successful amplification of the ITS region of several Hawaiian taxa.

Figure 4. PCR product from the successful amplification of the trnL-F region of several Hawaiian taxa.

34 Figure 5. PCR product from the successful amplification of ISSR Primer 807 of several Hawaiian taxa and relatives in the Geraniaceae family.

35 Figure 6. Phylogenetic tree (50% majority rule) from a parsimony analysis using branchand-bound search of ITS sequences of the 8 Hawaiian Geraniums and relatives in the Geraniaceae family, based on 52 parsimony-informative characters. Bootstrap values (1000 replicates) are found above the branches (CI = 0.853, RI = 0.893).

86

G. hillebrandii West Maui G. hanaense East Maui G. multiflorum East Maui

84 100

G. arboreum East Maui G. c. hypoleucum Hawai’i G. kauaiense Kaua’i

71

G. c. tridens East Maui G. c. hololeucum Hawai’i

99

G. richardsonii N. America 95

G. subulatostipulatum Mexico

99

G. vulcanicola Mexico G. grandiflorum Himalayas 99 71

G. retrorsum G. solanderi G. homeanum G. sessiliflorum

36 Figure 7. Phylogenetic tree (50% majority-rule) from a parsimony analysis using branch-and-bound search of trnL-F sequences of the 8 Hawaiian Geraniums and relatives in the Geraniaceae family, based on 19 parsimony-informative characters. Bootstrap values (362 replicates) are found above the branches (CI =0.962, RI = 0.895).

G. hillebrandii Weat Maui G. hanaense East Maui 65

G. multiflorum East Maui G. c. tridens East Maui

75

G. c. hololeucum Hawai’i G. kauaiense Kaua’i G. arboreum East Maui

98

G. c. hypoleucum Hawai’i G. richardsonii N. America 58

G. subulatostipulatum Mexico G. vulcanicola Mexico

98

G. pusilum G. robertianum G. grandiflorum

37 Figure 8. Phylogenetic tree (50% majority-rule) from a parsimony analysis of the combined ITS and trnL-F sequences of the 8 Hawaiian Geraniums and relatives in the Geraniaceae family, based on 30 parsimony-informative characters. Bootstrap values (1000 replicates) from a branch-and-bound search of the 50% majority-rule tree (CI = 0.936, RI = 0.926) are found above the branches. Below the branches are the bootstrap values (1000 replicates) from a distance analysis using neighbor-joining search. G. hillebrandii West Maui 91 92

G. hanaense East Maui G. multiflorum East Maui

58 64 G. c. hololeucum Hawai’i

83 82

G. c. tridens East Maui

100

G. kauaiense Kaua’i

100

66 66

100 100

G. arboreum East Maui G. c. hypoleucum Hawai’i G. subulatostipulatum Mexico G. vulcanicola Mexico G. richardsonii N. America

38 Figure 9. Phylogram of one of three equally-parsimonious trees from a parsimony analysis of the combined ITS and trnL-F sequences of the 8 Hawaiian Geraniums and relatives in the Geraniaceae family, based on 30 parsimony-informative characters, obtained from a branch-and-bound search (CI = 0.936, RI = 0.926). Numbers above the branches indicate the number of nucleotide substitutions.

G. hillebrandii West Maui

3

G. hanaense East Maui

G. multiflorum East Maui 1 2

G. c. hololeucum Hawai’i

14 2

1

9

4

G. c. tridens East Maui

G. kauaiense Kaua’i

G. arboreum East Maui

11 2

G. c. hypoleucum Hawai’i

6

G. subulatostipulatum Mexico

22 6

G. richardsonii N. America

5 changes

G. vulcanicola Mexico

39 Figure 10. Phylogenetic tree (50% majority-rule) from a distance analysis using UPGMA search of ISSR data matrix of the 8 Hawaiian Geraniums and relatives in the Geraniaceae family, based on 20 parsimony-informative characters Bootstrap values (1000 replicates) are found above the branches (CI = 0.547, RI = 0.147).

62

G. arboreum West Maui

G. c. hypoleucum Hawai’i

54

G. c. tridens West Maui

G. c. hololeucum Hawai’i

58

G. multiflorum West Maui

G. hanaense West Maui

G. hillebrandii East Maui

G. kauaiense Kaua’i

G. vulcanicola Mexico

G. richardsonii N. America

40 Figure 11. Habit/habitat information included on the phylogenetic tree based on the combined ITS and trnL-F data. G. hillebrandii West Maui

Erect subshrub Montane bog

G. hanaense East Maui

Decumbent subshrub Montane bog

G. multiflorum East Maui

Erect shrub Upper forest ecotone

G. c. hololeucum Erect shrub Hawai’i Alpine scrub G. c. tridens East Maui

Erect shrub Alpine scrub

G. kauaiense Kaua’i

Decumbent shrub Montane bog

G. arboreum East Maui

Diffuse tree Upper forest ecotone

G. c. hypoleucum Erect shrub Hawai’i Alpine scrub G. subulatostipulatum Mexico G. vulcanicola Mexico G. richardsonii N. America

41 LITERATURE CITED Áedo, C. and F.M. Garmedia. 1997. Twelve new names in Geranium L. (Geraniaceae). Kew Bulletin 52(3): 725-727. _____, _____, and F. Pando. 1998. World Checklist of Geranium L. (Geraniaceae). Anales Jardín Botánico de Madrid 56(2): 1-42. Álvarez, I. and J.F. Wendel. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417-434. Arnau, G., J. Lallemand, and M. Bourgoin. 2002. Fast and reliable strawberry identification using intersimple sequence repeat (ISSR) amplification. Euphytica 129: 69-79. Baldwin, B.G., D. Kyhos, J. Dvorak, and G. Carr. 1991. Chloroplast DNA evidence for a North American origin of the Hawaiian Silversword alliance (Asteraceae). Proceedings of the National Academy of Sciences of the U S A 88: 1840-1843. _____, M.J. Sanderson, J.M. Porter, M.F. Wojciechowski, C.S. Campbell, and M.J. Donoghue 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperms phylogeny Annals of the Missouri Botanical Garden 82: 247–277. _____ and B. Wessa. 2000. Origin and relationships of the tarweedSilversword lineage (Compositae-Madiinae). American Journal of Botany 87: 1890-1908. Ballard, Jr., H.E., and K.J. Sytsma. 2000. Evolution and biogeography of the woody Hawaiian violets (Viola, Violaceae): artic origins, herbaceous ancestry and bird dispersal. Evolution 54(5): 1521-1532. Baker, W.J., C.B. Asmussen, S.C. Barrow, J. Dransfield and T.A. Hedderson. 1999. A phylogenetic study of the palm family (Palmae) based on chloroplast DNA sequences from the trnL - trnF region. Plant Systematics and Evolution 219: 111-126. Bakker, F.T., A. Culham, L.C. Daugherty, and M. Gibby. 1999. A trnL-F based phylogeny for species of Pelargonium (Geraniaceae) with small chromosomes. Plant Systematics and Evolution 216: 309-324. _____, _____, P. Hettiarachi, T.Touloumenidou, M. Gibby. 2004. Phylogeny of Pelargonium (Geraniaceae) based on DNA sequences from three genomes. Taxon 53(1): 17-28.

42 _____, _____, C.E. Pankhurst, and M. Gibby. 2000. Mitochondrial and chloroplast DNA-based phylogeny of Pelargonium (Geraniaceae). American Journal of Botany 87: 727-734. Barrier, Marianne, R. H. Robichaux, and M. D. Purugganan. 2001. Accelerated regulatory gene evolution in an adaptive radiation. Proceedings of the National Academy of Sciences of the United States of America 98(18): 10208–10213. Bussell, J.D., M. Waycott, and J. Chappill. 2004. Arbitrarily amplified DNA markers as characters for phylogenetic inference. Perspectives in Plant Ecology, Evolution and Systematics 7: 3-26. Camacho, F.J. and A. Liston. 2001. Population structure and genetic diversity of Botrychium pumicola (Ophioglossaceae) based on inter-simple sequence repeats (ISSR). American Journal of Botany 88(6): 1060-1070. Carlquist, S. 1974. Island Biology. Natural History Press, New York, New York. _____. 1980. Hawaii, A Natural History. Pacific Tropical Botanical Garden, Lawai, Kauai, Hawaii. _____ and D.R. Bissing. 1976. Leaf anatomy of Hawaiian Geraniums in relation to ecology and taxonomy. Biotropica 8(4): 248-259. Carson, H.L., and K.Y. Kaneshiro. 1976. Drosophila of Hawaii: systematics and ecological genetics.” Annual Review of Ecology and Systematics 7: 311-345. Crawford, D.J., J.R. Whitkus, and T.F. Stuessey. 1987. Plant evolution and speciation on oceanic islands. In K.M. Urbansa (Ed.), Differentiation Patterns in Higher Plants, 183-199. Academic Press, New York, NY. Cronquist, A. 1981. An Intergrated Sustem of Classification of Flowering Plants. New York, Columbia University Press. _____. 1988. The Evolution and Classification of Flower Plants. New York, The New York Botanical Garden. Doyle, J.J and J.L. Doyle. 1987. A rapid isolation procedure for small quantities of leaf tissue. Phytochemical Bulletin 19: 11-15. Esselman, E.J., L. Jianquiang, D.J. Crawford, J.L. Windus, and A.D. Wolfe. 1999. Clonal diversity in the rare Calamagostris porteri ssp. insperata (Poaceae): comparative results for allozymes and random amplified polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) markers. Molecular Ecology 8: 443-451.

43 Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791. Fosberg, F.R. 1936. The Hawaiian Geraniums. Occasional Papers of the Bernice P. Bishop Museum 12: 1-19. Funk, V.A. and W.L. Wagner. 1995. Biogeography of seven ancient Hawaiian plant lineages. In W.L. Wagner and V.A. Funk (Eds.), Hawaiian Biogeography: Evolution on a Hot Spot Archipelago, 160-193. Smithsonian Press, Washington, DC. Ganders, F.R., M. Merbee, and M. Pirseyedi. 2000. ITS base sequence phylogeny in Bidens (Asteraceae): evidence for the continental relatives of Hawaiian and Marquesan Bidens. Systematic Botany 25(1): 122-133. Gardner, R.C., J. Keeling, P.J. de Lange, S.D. Wright, and E.K. Cameron. A New Zealand biodiversity database. Unpublished, direct submission. Submitted (15SEP-2004). School of Biological Sciences, University of Auckland, Private Bag 92019, Auckland, New Zealand. Gillespie, R.G. 2002. Biogeography of spiders on remote oceanic islands of the Pacific: archipelagoes as stepping stones? Journal of Biogeography 29: 655-662. Givnish, T. J., R. A. Montgomery, and G. Goldstein. 2004. Adaptive radiation of photosynthesis physiology in the Hawaiian light regimes, static light responses, whole-plant compensation points. American Journal of Botany 91(2): 228–246. Gemmill, C.E.C., G.J. Allan, W.L. Wagner, and E.A. Zimmer. 2002. Evolution of insular Pacific Pittosporum (Pittosporaceae): origin of the Hawaiian radiation. Molecular Phylogenetics and Evolution 22(1): 31-42. Gupta, M., Y.S. Chyi, J. Romero-Severson, and J.L. Owen. 1994. Amplification of DNA markers from evolutionarily diverse genomes using single primers of simple-sequences repeats. Theoretical and Applied Genetics 89: 998-1006. Gray, A. 1854. Phanerogamia of the United States Exploring Expedition. Reprint Verlag J. Cramer, Lehre, 1971. Hooker, W.J. 1837. Geranium cuneatum, Hook. Icon Plantarum pl. 2: pl. 198. Hillebrand, W. 1888. Flora of the Hawaiian Islands. Westermann, New York, NY. James, H. 2004. The osteology and phylogeny of the Hawaiian finch radiation (Fringillidae: Drepanidini), including extinct taxa. Zoological Journal of the Linnean Society 141: 207-255.

44 Jordan S., C. Simon, and D. Polhemus. 2003. Molecular systematics and adaptive radiation of Hawaii’s endemic Damselfly genus Megalgrion (Odonata: Coenagrionidae). Systematic Biology 52(1): 89-109. Jung, Y.H., K.H. Kim, S.H. Kang, S.J. Jun, M.Y. Oh, and S.C. Kim. 2003. Phylogenetic analysis of the genus Actinidia in Korea inferred from two non-coding chloroplast DNA sequences. Korean Journal of Genetics 25: 95-101. Lanner, R.M. 1964. Adventitious rooting – a response to Hawaii’s environment. U.S. Forest Service Research Note PSW-54. PacificSouthwest Forest and Range Experiment Station. Berkely, CA. Lindqvist, C. and V.A. Albert. 2002. Origin of the Hawaiian endemic mints within North American Stachys (Lamiaceae). American Journal of Botany 89(10): 1709-1724. _____, T. J. Motley, J.J. Jeffrey, and V.A. Albert. 2003. Cladogensis and reticulation in the Hawaiian endemic mints (Lamiaceae). Cladisitics 19: 480-495. Loope, L.L., O. Hamann, and C.P. Stone. 1988. Comparative Conservation Biology of Oceanic Archipelagoes. BioScience 38(4): 272-282. Lowrey, T.K. 1995. Phylogeny, adaptive radiation, and biogeography of Hawaiian Tetramolopium (Asteraceae, Astereae). In W.L. Wagner and V.A. Funk (Eds.), Hawaiian Biogeography: Evolution on a Hot Spot Archipelago, 195220. Smithsonian Press, Washington, DC. MacDonald, G.A., A.T. Abbott, and F.L. Peterson. 1983. Volcanoes in the Sea – the Geology of Hawaii. 2nd Ed. Honolulu, University of Hawaii Press. Maunder, M., A. Culham, A. Bordeu, J. Allainguillaume, and M. Wilkinson. 1999. Genetic diversity and pedigree for Sophoro toromiro (Legumiaceae): a tree extinct in the wild. Molecular Ecology 8: 725-738. Martins, M., R. Tenreiro, and M.M. Oliveira. 2003. Genetic relatedness of Portuguese almond cultivars assessed by RAPD and ISSR markers. Plant Cell Reports 22: 71-78. Medeiros, A.C. and H. St. John. 1988. Geranium hanaense (Geraniaceae), a new species from Maui, Hawaiian islands. Brittonia 40(2): 214-220. Mort, M.E., D. Crawford, A. Santos-Gurra, et al. 2003. Relationships among the Macaronesian members of the Tolpis (Asteraceae: Lactuceae) based upon analysis of inter simple sequences repeat (ISSR) markers. Taxon 52: 511-518.

45 Nepokroeff, M., K.J. Sytsma, W. L. Wagner, and E.A. Zimmer. 2003. Reconstructing ancestral patterns of colonization and dispersal in the Hawaiian understory tree genus Psychotria (Rubiaceae): a comparison of parsimony and likelihood approaches. Systemic Biology 52(6):820–838. Olmstead, R.G. and J.D. Palmer. 1994. Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81: 1205-1224. Pax, D.L., R.A. Price, and H.J. Michaels. 1997. Phylogenetic position of the Hawaiian geraniums based on rbcL sequences. American Journal of Botany 84: 72-78. Price, J.P. and D.A. Clague. 2002. How old is the Hawaiian biota? Geology and phylogeny suggest recent divergence. The Royal Society. (B)269: 2429-2435. _____, and W.L. Wagner. 2004. Speciation in Hawaiian angiosperm lineages: cause, consequences, and mode. Evolution 58(10): 2185-2200. Sakai, A.K., W.L. Wagner, D.M. Ferguson, and D.R. Herbst. 1995. Biogeographical and ecological correlates of dioecy in the Hawaiian flora. Ecology 76: 25302543. Selvi, F., A. Papini, H.H. Hilger, M. Bigazzi, and E. Nardi. 2004. The phylogenetic relationships of Cynoglottis (Boraginaceae-Boragineae) inferred from ITS, 5.8S and trnL sequences. Plant Systematics and Evolution 246: 195-209. Shaw, K. L. 2002. Conflict between nuclear and mitochondrial DNA phylogenies of a recent species radiation: what mtDNA reveals and conceals about modes of speciation in Hawaiian crickets. Proceedings of the National Academy of Sciences of the United States of America 99(25): 16122-16127 Small, R., R.C. Cronn, and J.F. Wendel. 2004. L.A.S. Johnson review no. 2: use of nuclear genes for phylogeny reconstruction in plants. Australian Systematic Botany 17: 145-170. Sudupak, M.A. 2004. Inter and intra-species inter simple sequence repeat (ISSR) variations in the genus Cicer. Euphytica 135: 229-238. Swofford, D.L. 2001. PAUP*: Phylogenetic Analysis Using Parsimony (* and other methods). Version 4, Sinauer, Sunderland, Massachusetts. Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109.

46 Thompson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin, and D.G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876– 4882. Vargas, P., B.G. Baldwin, and L. Constance. 1998. Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae). Proceedings of the National Academy of Sciences of the United States of America 95(1): 235-240. Wagner, W.L., D.R. Herbst and S.H. Sohmer. 1990. Manual of the Flowering Plants of Hawai’i. Honolulu, University of Hawai’i, Bishop Museum Press. White, T.J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds.), PCR protocols: A Guide to Methods and Application, pp. 315–322. Academic Press, San Diego. Wolfe, A.D., and A. Liston. 1998. Contributions of PCR based methods to plant systematics and evolutionary biology. In P.S. Soltis, D.E. Soltis, and J.J. Doyle (Eds.), Molecular Systematics of Plants II, 43-86. Chapman and Hall, New York. _____, Q. Xiang, S.R. Kephart. 1998. Assessing hybridization in natural populations of Penstemon (Scrophulariaceae) using hyper-variable intersimple sequence repeat (ISSR) bands. Molecular Ecology 7: 1107-1125. Yeo, P.F. 1984. Fruit-discharge-type in Geranium (Geraniaceae): its use in classification and its evolutionary implications. Botanical Journal of the Linnean Society 89: 1-36. Yockteng, R., H.E. Ballard, Jr., G. Masion, I. Dajoz, and S. Nadot. 2003. Relationships among pansies (Viola section Melanium) investigated using ITS and ISSR markers. Plant Systematics and Evolution 241: 153-170. Zietkiewicz, E., A. Rafalski, and D. Labuda. 1994. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20: 176-183.

47 APPENDICES Appendix A – Nomenclature of the Hawaiian Geraniums An agreement on exactly how many species and subspecies there are among the Hawaiian Geraniums is something to be desired. By W.J. Hooker in 1937, G. cuneatum was the first Hawaiian Geranium species to be described. Fosberg (1936) recognized G. arboreum, two varieties of G. multiflorum (canum and typicum), four varieties of G. cuneatum (tridens, hololeucum, hypoleucum, and Menziesii), and two varieties of G. humile (mauiensis and kauaiensis). Carlquist and Bissing (1976) recognized G. arboreum, two subspecies of G. multiflorum (multiflorum and ovatifolium), four subspecies of G. cuneatum (cuneatum, hololeucum, hypoleucum, and tridens), and two subspecies of G. humile (humile and kauaiense). Medeiros and St. John (1988) described a new species, G. hanaense. In 1990 Wagner et al. recognized G. arboreum, G. multiflorum, G. hanaense, G. humile, G. kauaiense, and the previously mentioned subspecies of G. cuneatum. In 1995 Funk and Wagner elevated the subspecies G. c. tridens to specific level. In 1997 Áedo and Garmendia acknowledged the name change of G. humile to G. hillebrandii and made a special note that G. hillebrandii and G. kauaiense are indeed separate species. For the sake of this research, nine taxa are recognized: G. arboreum, G. multiflorum, G. hillebrandii, G. hanaense, G. kauaiense, G. cuneatum ssp. cuneatum, G. c. ssp. hololeucum, G. c. hypoleucum, and G. c. ssp. tridens.

48 Appendix B – Detailed Protocols CTAB Isolation Use the IEC clinical centrifuge at room temperature. Hot Grind: Pre-warm mortar, pestles, and 2x CTAB buffer at 65°C. Grind 0.15 g dried tissue with a pinch of sterile sand in 15 ml 2x CTAB buffer. Transfer to 50 ml centrifuge tube. Rinse mortar and pestle with 5 ml 2x CTAB buffer and add the rinse solution to the tube. Cold grind: Put mortars and pestles in the freezer to chill. Pre-warm 2x CTAB buffer at 65°C. Grind about 1 gram frozen tissue in chilled mortar with a small amount of liquid nitrogen. Once the nitrogen boils away, scoop ground powder into 50 ml centrifuge tube. Rinse mortar and pestle with 20 ml 2x CTAB buffer and pour solution into the tube. After grinding, incubate/shake slowly at 65°C for 40 minutes. Extract with 20 ml SEVAG (24:1 chloroform: isoamyl alcohol) in hood. Mix gently. Burp before centrifuging (IEC clinical centrifuge) at level 7 for 4 minutes. Remove aqueous phase with nipped plastic transfer pipette. Put the aqueous phase in a new 50 ml centrifuge tube. Add 2/3 volume -20°C isopropanol (e.g. 11 ml isopropanol to 16 ml sample). Put in -20°C freezer overnight. Centrifuge at level 5 for 6 minutes. Pour off supernatant (watch for sliding pellet). Add 5 ml wash buffer (10mM NH4OAc, 76% EtOH), dislodge pellet, and let it sit for 15 minutes. Spin down DNA at level 3 for 5 minutes; pour off liquid. Prop at an angle down to air dry and remove alcohol. Let it set for 30-60 minutes. Put in vacuum-oven with no heat for about 30 minutes. Re-suspend in TE (100-400 μl, depending on the pellet).

49 Qiagen Mini Spin Columns Use the CLP Silent Spin centrifuge at room temperature. Before starting, prepare a 65°C water bath, a bucket of ice, and six 1.5 ml tubes for each sample (3 tubes will need to have the caps nipped off). Transfer genomic DNA sample to 1.5 ml tube. Raise volume to 400 μl using Buffer AP1. Add 4 μl RNAse A. Incubate in water bath at 65°C for 10 minutes, mix (invert tube) 2-3 times during incubation. Add 130 μl Buffer AP2. Incubate on ice for 5 minutes. The solution will get very cloudy. Centrifuge at 14K rpm for 5 minutes. Pipette supernatant to lilac QiaShredder column. Centrifuge at 14K rpm for 2 minutes. Transfer the flow-through to a new tube (measure how much there is). Add 1.5 volumes (of the flow-through) of Buffer AP3 and mix well. Transfer 650 μl of the solution to a mini column. Centrifuge at 8K rpm for 1 minute. Apply the rest of the solution to the mini column and centrifuge again. If there is gelatinous material in the column, centrifuge it a little longer. Add 500 μl Buffer AW, centrifuge at 8K rpm for 1 minute. Pour off flow-through. Add 500 μl more Buffer AW, centrifuge for 2 minutes at 14K rpm. Throw away flow-through collection tube. Put column in a new 1.5 ml tube. Add 100 μl Buffer AE. Incubate at room temperature for 5 minutes. Centrifuge at 8K rpm for 1 minute to elute (Elution A). Add 100 μl more Buffer AE, incubate, and centrifuge for Elution B.

50 PCR – ITS, trnL-F (50 μl reaction) 5 μl 10x MgCl2–free buffer 8 μl dNTP mix (1.25 mM each dNTP – 62.5 μl each 10mM dNTP plus 250 μl water) 1 μl Primer 1 (10 μM) 1 μl Primer 2 (10 μM) 5 μl MgCl2 (25 mM) 0.5 μl taq (2.5 Units) 1 μl template 28.5 μl dH2O Thermocycler profile (“SARAH”) 1) 2) 3) 4) 5) 6) 7)

95°C for 00:03:00 95°C for 00:01:00 54°C for 00:01:00 72°C for 00:02:00 34 times to (2) 72°C for 00:08:00 hold at 4°C

Primer Name

Primer Sequences (5'-3')

TABC TABF ITS1 ITS4

CGAAATCGGTAGACGCTACG ATTTGAACTGGTGACACGAG TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC

51 PCR – ISSR (25 μl reaction) 2.5 μl 10x MgCl2–free buffer 2.5 μl BSA (4 mg/ml) 4 μl dNTP mix (1.25 mM each dNTP – 62.5 μl each 10mM dNTP plus 250 μl water) 2 μl Primer (10 μM) 1.5-3 μl MgCl2 (25 mM) 0.1 μl taq (2.5 Units) 2 μl template Thermocycler profile (“ISSR”) 1) 2) 3) 4) 5) 6) 7)

94°C for 00:02:00 94°C for 00:0:40 44°C for 00:00:45 72°C for 00:01:30 39 times to (2) 72°C for 00:05:00 hold at 4°C

Primer Name UBS807 UBS810 ISSR Manny

Primer Sequences (5'-3') AGAGAGAGAGAGAGAGT GAGAGAGAGAGAGAGAT CACCACCACCACRC

52 Ethanol Precipitation of PCR Product with Sodium Acetate Use the CLP Silent Spin centrifuge at 4°C with strip tube adapter. Bring each sample up to 50 μl by adding dH2O. Add 1/10 volume of 3 M NaOAC pH 5.2 (1/10 of 50 μl = 5 μl). Add two volumes (2 x 50 μl = 100 μl) of 100% EtOH. Gently mix and refrigerate at -20°C for at least 20 minutes (or overnight). Centrifuge at 14K rpm for 10 minutes. Carefully pipette off ethanol. Add two volumes (2 x 50 μl = 100 μl) 70% EtOH and centrifuge again for 10 minutes. Pour off ethanol. Let dry in vacuum oven (no heat) for 25 minutes. Re-suspend in dH2O.

53 Sequencing Reaction 10 μl reaction 2 μl BigDye® Terminator v3.1 Cycle Sequencing Ready Reaction Mix 2 μl BigDye® 5x Sequencing Buffer 2 μl Primer (10 μM) 1 μl template 3 μl dH20 Thermocycler Profile (“BIGSARAH”) 1) 2) 3) 4) 5) 6)

95°C for 00:03:00 95°C for 00:00:15 60°C for 00:04:00 72°C for 00:02:00 24 times to (2) hold at 4°C

Primer Name

Primer Sequences (5'-3')

TABC TABF ITS1 ITS4

CGAAATCGGTAGACGCTACG ATTTGAACTGGTGACACGAG TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC

54 Ethanol Precipitation of Sequencing Reaction with Sodium Acetate Use the CLP Silent Spin centrifuge at 4°C with strip tube adapter. Add 1/10 volume of 3 M NaOAC pH 5.2 (1/10 of 10 μl = 1 μl). Add two volumes (2 x 10 = 20 μl) of 100% EtOH. Gently mix and refrigerate at -20°C for at least 20 minutes (or overnight). Centrifuge at 14K rpm for 10 minutes. Carefully pipette off ethanol and salt. Add two volumes (2 x 10 = 20 μl) 70% EtOH and centrifuge again for 10 minutes. Pipette off ethanol and salt. Let dry in vacuum oven (no heat) for 25 minutes.

In-house sequencing: re-suspend in 12 μl TSR (template suppression reagent). Sending it out: do not re-suspend, send out dry. (GeneGateway re-suspends with ABI HiDye Formamide).

55 Sequencing Denature samples at 98ºC for 5 minutes (Thermocycler program “HOTCOLD”). Keep samples on ice until ready to put them in the sequencer.

56 Appendix C – Sequences ITS G. arboreum ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGTGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCNAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGCTTGCGGTGCGGACAGTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCC CGGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGC TGCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATGT GNNACCCCAGNNCAGGCGGGGCACCCGCNAAT G. multiflorum ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGGGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGGTTGCGGTGCGGACAGTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCC CGGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGC TGCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCT GCGACCCCAGGTCAGGCGGGGCTACCCGCTGAAT G. hanaense ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGGGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGGTTGCGGTGCGGACAGTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCC CGGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGC TGCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCT GCGACCCCAGGTCAGGCGGGGCTACCCGCTGAATT G. hillebrandii ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGGGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTANCCCCGGAAACGGGCGAGGG TGGTTGCGGTGCGGACAGTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCC CGGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGC TGCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCT GCGACCCCAGGTCAGGCGGGGCTACCCGCTGANTT

57

G. kauaiense ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGTGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCNC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGCTTGCGGTGCGGACATTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCCC GGACGCTCTGCTCGGCAGCCGACGGTGGTTGAGAAGCCCTNGAAAACGTGCTGCTGCATTGCT GCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCTG CGACCCCAGTCAGGCGGGGCTACCCGCTGAATT G. c. tridens ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGTGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGCTTGCGGTGCGGACATTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCCC GGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGCT GCCCGATGTGGACCCTGTGACCCNTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCTG CGACCCCAGGTCAGGCGGGGCTACCCGCTGAATT G. c. hololeucum ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGTGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGNTTGCGGTGCGGACATTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCCC GGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGCT GCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATCTG CGACCCCAGGTCAGGCGGGGCTACCCGCTGATT G. c. hypoleucum ATTGTCGAACCCTGCACAGCAGAGCGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGTGCCTGCGCCCCCCGCAACCCGATGTCGGGTGATTGGGGGAAGCCCACTCTGCCCGACAA AAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCGC CCGTTCGCGGGAAGCGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACG GATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG AATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCAC GCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCTAACCCCGGAAACGGGCGAGGG TGCTTGCGGTGCGGACATTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGTCCC GGACGCTCTGCTCTGCAGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCATTGCT GCCCGATGTGGACCCTGTGACCCTTGCGCGACCTCTCCCCACCGGGCGAGGGAGCTCCATGTG AGACCCCAGNNCAGGCGGGGNACCCGCNAATA

58 G. richardsonii ATTGTCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTTAACAAACTGCGGGGAACGGGT GGTGCCTGCACCCCCCGCAACCCGATGTCGGGGGATTGGGCGGAAGCCCACTCTGCCCGACA AAAAACGTACCCACGGCGCGGTCCGCGTCAAGGAATCGAAACGAAGCAACGTGTGCAGTCCG CCCCGTTCGCGGGAAGCGGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAA CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGC AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGG CACGCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCGAACCCCGGAAACGGGTATG GGTGCTTGCGGTGCGGACATTGGTCTCCCGTGTGCCCTGCTCGCGGCTGGCCTAAATTTGAGT CCCGGACGCTCTGTTCTGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAACGTGCTGCTGCAGT GCTGCCTGATGCGGACCCTGTGACCCTTGCGCGACCTCTCCCCACTGGGCGAGGGACCTCCAT CTGAAACCCCAGGTCAGGCGGGNGN G. subulatostipulatum ATTGTCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGA GGTGCCTGCACCCCCCGCAACCCGATGTCGGGGGATTTGGCGGAAGCCTACTCTGCCCGACAA AAAACGTACCCCNGGCGCGGTCCGCGCCAAGGAACCGAAACGAAGCAACGTGTGTAGTCCGC CCCGTTCGCGGGAAGCGGACGACAACACGGTCTTCCAATATATACTAAACGACTCTCGGCAAC GGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCA GAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGCA CGCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCGAACCCCGGAAACGGTCCAGG GCTTGCGGTGCGGACATTGGTCTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGTCCC GGACGCTCTGTTATGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGTGCTGTTGCAGTGCT GCCCGATGCGGACCCTATGACCCTTGCGCGACCTCTCCCCACTGGGCGAGGGAGCTCCATCTG CGACCCCAGGTCAGGCGGGGATACCCGCTGATT G. vulcanicola ATTGTCGAACCCTGCACAGCAGAACGACCCGTGAACTCGTTAACAAACCGCGGGGAGCGGGA GGTGCCTGCACCCCCCGCAACCCGATGTCGGGGGATTGGGCGGAAGCCTACTCTGCCCGACA AAAAAAGTACCCCCGGCGCGGTCCGCGCCAAGGAACCGAAACGAAGCAACGTGTGCAGTCCG CCCCGTTCGCGGGAAGCGGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAA CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGC AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCCGAGGGC ACGCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCGAACCCCGGAAACGGTCCAG GGCTTGCGGTGCGGACATTGGTTTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGTCC CGGACGCTCTGTTATGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGTGCTGTTGCAGTGC TGCCCGATGCGGACCCTTTGACCCTTGCGCGACCTCTCCCCACTGGGCGAGGGAGCTCCATCT GAAACCCCAGGTCAGGCCNGCAGAGNNATAGT G. grandiflorum ATTGTCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTTAACAAACCGCGGGGAGCGGGT GGCGCCTGCGCCCCCCGCAACCCGATGTCGGGGGCTTGGGCGGAAGCCCGTGCTGCCCGACA AAAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGCGTGCAGTACG CCCCGTTCGCGGGAAGTGGACTGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAA CGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGC AGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGG CACGCCTGCCTGGGCGTCACGCGCTCCGTCGCACCTCAACCCCGAACCCCGAAACGGGCCAG GGTGCTTGTGGTGCGGAGATTGGTCTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGT CCCGGACGCTCTGTTCTGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGTGCTGCTGCAGT GCTGCCCGATGCGGACCCTGTGACCCTTGCGCGACCTCTCCCCTTGGGGTGAGGGAGCTCCAT CTGAGACCCCAGGTCAGGCGGGGCTACCGCTGAATTT

59 trnL-F G. arboreum CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCCTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTATATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAGATTGACATA AACTCAAGTCATCTAATAAAATAAGGGAAGAT G. multiflorum CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAAAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTTAATTGACATAA ACTCAAGTCATCTAATAAAATAAGGGAT G. hanaense CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAAAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCANTANTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTTAATTGACATAA ACTCAAGTCATCTAATAAAATAAGGGAT

60 G. hillebrandii CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAAAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTTAATTGACATAA ACTCAAGTCATCTAATAAAATAAGGGAT G. kauaiense CCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCTC AGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA ATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAAG GGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAATG TGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGAC CCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGAG TCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGAT GTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCCT AACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCTT TATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTGC GGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGGAT TCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAAGA AATGCGGAGCGTGGAAAAGACTCAAAATCCTTGNTTCGTCATTTTTTTTAATTGACATAANCC AAGTCATCTATNAAATANGGGAT G. c. tridens CCCTGGAATAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCTC AGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA ATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAAAAAGGGCAAG GGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTTAATTGACATAA ACTCAAGTCATCTAATAAAATAGGGAT

61 G. c. hololeucum CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAAAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGACAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTCTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTTAATTGACATAA ACTCAAGTCATCTAATAACATAAGGCAAT G. c. hypoleucum CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCNTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCNATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTNAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTGGANAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTC TTTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTT GCGGTNTATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAG GATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTA AGAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAATTGACATA AACTCAAGTCATCTAATAAAATAAGGGAT G. richardsonii CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGAAAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTC TTTATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCT TGCGGTATATATGACACACGGACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAA GGATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCT AAGAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAATTGACAT AAACTCAAGTCATCTAATAAAATAAGGGAT

62 G. subulatostipulatum CCCTGGAATATAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCTC AGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA ATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAAG GGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAATG TGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGAC CCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGAG TCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGAT GTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCCT AACTCTTTGCTGCCTTTCAATTTTGAAAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTCT TTATTTTACTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTTG CGGTATATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGG ATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAA GAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAATTGACATAA ACTCAAGTCATCTAATAAAATAAGGGAT G. vulcanicola CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCCTCAGAAAGGGCAA GGGTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAGATGATTAATGAAAAT GTGAGTCCGTATATATAGAGAATTTATATATAAGAATCCAATAGTCATTGATCAAATCATTGA CCCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGA GTCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGA TGTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCC TAACTCTTTGCTGCCTTTCAATTTTGAAAGGGTTTCCAAATTTGTTATCTTTCTCATTTCTTCTC TTTATTTTACTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTTCCTCTTATCACAGGTCTT GCGGTATATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAG GATTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTA AGAAATGCGGAGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAATTGACATA AACTCAAGTCATCTAATAAAATAAGGGAT G. grandiflorum CCCTGGAATAAAAGAGGGGCAATCCTGAGCCAAATCCTTTTTTACGAAAATAAAGAGGGTCT CAGAAAGCGAGAATAGAAAAAAAAGGACAGGTGCAGAGACTCAATGGAAGCTGTTCTAACA AATGGAGTCGGCTGCTTTACGTTGATAAAGGAAGCCTTCTATCGAACCTTCAGAAAGGGCAAG GCTAAACCTATATATACGTACTGAAAGATTGCTTCAAATGATTTCAAATGATTAATGAAAATG CGAGTCCGTATATATAGAGAATTTATATATAAGAATCGAATAGTCATTGATCAAATCATTGAC CCCAGAGTCTGATGGATCTTTTCTTTTGAATAACGGATTAATCGGACGAGAATAAAGAGAGAG TCCTGTTCTACATGTCAATAACAGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGAT GTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAACAAAGTCTCCTTCAACTCCCTTCCCT AACTCTTTGCTGCCTTTCAATTTTGAAAGGGTTTCCAAATTTGTTATCTTTTTCATTTCTTCTCTT TATTTTCCTTTTTCACAAAAAAAGTACCCAATAGACCCTTTTTTCCTCTTATCACAGGTCTTGC GGTATATATGACACACGTACAAAGGGGATGGCCCAGGAACCCTCATGTGATTTGTTGAAGGA TTCAGAATCCATATTTGTACATTACGCGTTTTGTACAAAGTCTTCTTTTTTTTAAGGATCTAAG AAATGCGGGGCGTGGAAAAGACTCAAAATACCTTGTTTCGTCATTTTTTTGAATTGACATAAA CTCAAGTCATCTAATAAAATAAGGGAT

View more...

Comments

Copyright © 2017 DOCIT Inc.